Thursday, November 28, 2019

Organisational culture free essay sample

Organisational culture is the pattern of assumptions, vaules and norms shared by organisational members. The culture of an organisation can affect the operations of a company and how successful it is. Organisational culture contains four basic elements; basic assumptions which are un-said but happen, shared values which show what is important in the company, norms which the employee should follow and artefacts which show the culture of the organisation. An example of organisational culture in Alphabet Games is the shared value of trying to make their games as up-to-date as possible. They want to be able to compete with rival companies and continue to improve on all aspects of gameplay. This helps them to succeed and meet the demands of gameplayers. Alphabet Games has the basic assumption of they want to survive. As a small company they continue to grow and expand, keeping up with bigger corporate brands. They want to obtain possible benefits and stay on the market as long as they can. We will write a custom essay sample on Organisational culture or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page The quality of their products have helped the business to grow and be successful through difficult times. Using the Deal and Kennedy model, which has four cultural classifications; tough guy, work hard and play hard, bet the organisation and process, Alphabet Games fits into more than one classification. Alphabet Games can be seen to be in the â€Å"work hard and play hard† classification. This culture had a quick feedback/reward system and takes few risks. They value their customers and always want to meet the needs and wants of the consumer – the focus is one the customer in Alphabet Games, meeting the customers’ expectations. The focus in Alphabet Games is on the team instead of the individual. Any stress which may arise is more likely to come from the amount of work rather than being uncertain – the game developers at AG are trained in what they do and are unlikely to be unsure about what they are doing unless it is through miscommunication. However, aslong as the employee can keep up, the work will get done. Using Handy’s â€Å"how to describe your organisation† model, we could imagine if Alphabet Games worked on a Person Culture approach. In this approach, the individual is at the central point, meaning that all the focus is on the worker, this would move away from the consumer-based focus Alphabet Games currently works with. This could prevent them from moving forward, possibly falling behind with technological advancements and losing their reputation. On this approach there is no structure and no shared goal. Alphabet Games works together with a common goal of delivering to the customer, which they are well known for. Straying away from this will damage the reputation of the company, lose them money/profits and potentially end in the fall of Alphabet Games. Organisational culture and organisational behaviour are two separate concepts but are related to each other by the means of the way they work together. It is the shared values that help to shape the activities of the organisation is known as organisational culture. The way employees in the organisation behave has a consequence on the organisational culture, this is known as organisational behaviour. Both are crucial in the way the company works because they control if the organisation is successful or not. Again, using Deal and Hardy’s model of organisational culture, we can see way in which the â€Å"Work hard, Play hard† concept can effect Alphabet Games. Everyone is encouraged to be a team player, the behaviour of the employees in Alphabet Games would be different under a workplace that used an approach that the individual was valued. The team players will be more united that those who achieve individually. This is due to individuals competing against each other, rather than uniting as a unit to achieve objectives.

Sunday, November 24, 2019

TERROISM UNIT 9 Essay Example

TERROISM UNIT 9 Essay Example TERROISM UNIT 9 Essay TERROISM UNIT 9 Essay Terrorism Name: Course: Institution: Tutor: Date: Terrorism The Impact of Terrorism on the Police Mission Terrorists attacks in the U.S have made a significant different in many departments of the federal. The security department is the most affected. The police department in specific has had to come up with several policies and make a few changes in order to make the significant impact. Concerning the police mission, they are now more careful and more analytical in every case or suspicion they handle (The Council of State Governemnts, 2005). They are no longer only analytical with the immigrants only, but now they are also analytical on the citizens. This is because some attacks have been made by the U.S citizens. To the police, every body is a suspect and capable of either carrying out or facilitating a terrorist attack. Although the terrorist attacks are more serious than the local deaths as they lead to more deaths and casualties, the crimes performed in the neighborhood or locally are taking longer to solve. The police are paying too much attention to the big crimes and overlooking some things that lead to the small crimes. Unlike in the past decades, today, special units have been set aside to specialize in terrorist activities, which include terrorist, groups, threats and those countries that are hosts to terrorist groups such as the Middle East countries (Bayley Perito, 2010). Nowadays, the police department has put it upon itself to monitor the immigrants more critically than before. The monitoring is more critical on the immigrants from the Arab countries or countries that are considered a threat to the U.S. The police mission is to protect all the people of the United States. For this case, there are security issues that have been emphasized as compared to other issues especially after the 9/11 attack. There are more security check-ups, more scrutiny on immigrants and through follow-up on the slightest suspicion of any terrorist threat or activity. Appropriate Law Enforcement Behavior The immigration policy is one of the most prominent arguments relating to the terrorism issues in the United States. The disagreements concern the extent at which the immigrants’ privacy and activities should be monitored. The president argues that the immigrants should be given the same freedom and treatment as the other American citizens, while the other opposing parties argue that there should be stricter policies governing immigration and the immigrants. These include limiting the number of immigrants who are being granted the American citizenship, putting more security at the borders, more scrutiny and vetting at the American embassies before people are given visas to come to the United States amongst other policies ad regulations (Bayley Perito, 2010). It is true that some precautions and regulations interfere with the people’s liberty. For example, the American streets, roads and buildings are filled with cameras. Although it is a protection measure, there are those who argue that too many cameras are interfering with the people’s privacy. In other cases, the concerned federal authorities in charge of security listen to the phone conversations, read the emails and text messages of the people. These extreme measures are more applied on the immigrants who are from the countries hosting terrorist organizations and those being suspected of engaging in suspicious activities. Since the 9/11 attack, stricter measures have been taken (Schulhofer, 2002). However, there are those who argue that these strict measures are affecting particular groups as compared to all the people. Immigrations policies are stricter, limiting the level of legal migration as much as they can, in order to lower the risk of terrorists entering the country. The strict monitoring of the borders and the limiting the level of legal immigration is beneficial. However, these policies should not interfere with the privacy and the liberty of the people of America. This is what the president is putting across. Social Stigma and Police Ethics The social stigma on immigrants from the Arab countries or the people of the Muslim religion has made the police department more careful of their ethical conduct especially after the 9/11 attack (Schulhofer, 2002). Although the police may be tempted to suspect any person from Muslim countries thus being more critical with them as compared to the other countries, it is unethical for them to have legally acceptable reasons when conducting any surveillance or for invading any form of their privacy. There is also a social stigma on the immigrants especially with the ongoing debates concerning the level of legal migration that should be allowed. This area touches on the ethical values of the people. It is ethically required of the police to treat all people, no matter the background, origin, gender or race, in line with their rights, even though they have enough evidence connecting them with a particular criminal act. It is also required of them to follow the right procedures when follow up on a lead concerning a terrorist activity or a suspect (Bayley Perito, 2010). Social stigma has played a role in reducing police corruption. For example, any suspicion of any terrorist activity is being taken seriously as compared to the previous years. In the past, one had to have concrete evidence before any suspected terrorist activity was given the concentration it deserves (The Council of state Governments, 2005). The checks in the airports, train stations and other transport stations were on as severe as it is today. Police were not as careful as they are today. All the immigrants are being fully searched despite their country of origin. Ethical Forces and Police Corruption The ethical forces behind the police corruption are not different with the ethical forces behind the use of police force. The ethical forces concerning police corruption are a matter of how the police conduct themselves. Similarly, the ethical forces behind police force concern the police treatment of the public. Both ways concern the public. For example, the police are required to treat every situation with the seriousness it deserves. The police are asked not to accept any bribes or tokens form the public as a way of motivating them to act. This ethical force requires them to follow the right procedures whether they are dealing with a terrorism case or a case concerning the local crimes (Bayley Perito, 2010). If a member of the public comes in with a claim that he/she has been molested and then another member comes in with a claim that he/she is suspecting a terrorist activity, both cases should be attended. Leaving one case unattended and putting all the concentration on the othe r is not in line with ethical forces. However, the suspicion on terrorist activity may be allocated more resources as compared to the former. Individual Conscience and Police Assignments Police are people who have a conscience just like the rest of the public. Like any other people, they are tempted to act in accordance with their conscience. However, this is against their ethical and professional requirements. For example, they are cannot just start searching someone (invading privacy) because they ‘feel’ that something is not right. They must have tangible evidence. A police officer cannot stop a Muslim citizen or an immigrant from an Arab country because they suspect that he is engaging in terrorism activity. There must be evidence to prove this ‘feeling’ (Bayley Perito, 2010). The individual conscience should not interfere with a police officer’s assignment. The right procedures should be followed and when any arrests or searches are made. This is despite the fact that a police officer may have a few ‘hunches’, connecting the suspect with the activities (Schulhofer, 2002). If they are not legally acceptable, the police officer cannot act entirely on the conscience. However, a police officer can follow up on a lead or a suspicion without interfering with the rights of the individual. If the police find legal reasons warranting of other extreme measures, then they can be taken. Police training on Ethical Dilemmas Police encounter and will continue to encounter ethical dilemmas in the field or in their assignment. This is because there are situations that come where one needs to take either of the extreme measure. If a one fails to know hoe to handle an ethical dilemma when in training, it might harder for the individual to handle it when he/she comes across such a situation. It is therefore significant ethical dilemma training be done before one is released to take up the real life assignments. This can be done by preparing the officers that they will come across cases where they have to choose between bad and good (Bayley Perito, 2010). For example, one might come across a situation where he/she has to shoot a relative, friend, or close family member in order to save victims of a perpetrator. This is if the family member or the relative is the perpetrator. In many cases, people in the police department may be forced to make many sacrifices. Sometimes, these sacrifices involve choosing the public over ones family. It also involves risking the life of one in order to save many. Although this is easier when being theoretically taught than when one practically experiences it, the training prepares the officers psychologically. It is also good for the department to have professional councilors or psychologists so that these officers are well taken care of when such situations come up (Bailey Perito, 2010). References Bayley, D. H., Perito, R. (2010). The police in war: Fighting insurgency, terrorism, and violent crime. Boulder: Lynne Rienner Publishers. Schulhofer, S. J. (2002). The enemy within: Intelligence gathering, law enforcement, and civil liberties in the wake of September 11. New York: Century Foundation Press. The Council of State Governments. (2005). The Impact of Terrorism on State Law Enforcement. Eastern Kentucky University, April.

Thursday, November 21, 2019

Describe the development of India's financial sector over the last Essay

Describe the development of India's financial sector over the last decade. Support your claims with as much as data possible - Essay Example n India 2003-04, talks about the appropriate timing of the entry of foreign banks into India so as to be co-terminus with the transition to greater capital account convertibility (Thankur, 1990). This shows that the economic policy establishment in India, including the RBI, has not drawn adequate lessons from the experiences of the financial crisis-affected countries. Besides, banks are the principal risk carriers in the system, taking in small deposits that are liquid and making relatively large investments that are illiquid and can be characterised by substantial income and capital risk. The observed tendency among some promoters or boards of banks to divert a substantial share of its deposits into speculative activities in which the promoter or board may be interested or into investments that are risky but promise quick returns, can increase financial fragility, lead to bank failures and if the magnitude of the failure is serious enough, can actually precipitate crisis for the entire financial system (Thankur, 1990). Instances in India such as the Nedungadi Bank and the Global Trust Bank are the harbingers of what may follow if reckless deregulation of the banking sector is carried out. In fact, the experience of recurrent financial crises in the 1990s, most famously the East Asian experience, has shown how banking deregulation along with capital market liberalization often serves as recipes for financial turmoil in developing countries (Desai, 1987). Many guidelines have stated among other things that no single entity or group of related entities would be allowed to hold shares or exercise control, directly or indirectly, in any private sector bank in excess of 10 % of its paid-up capital. Recognising that the 5th March notification by the Union Government had hiked foreign investment limits in private banking to 74%, the guidelines sought to define the ceiling as applicable on aggregate foreign investment in private banks from all sources (FDI, Foreign

Wednesday, November 20, 2019

Linux Enterprise Study Essay Example | Topics and Well Written Essays - 2500 words

Linux Enterprise Study - Essay Example Linux was first developed by Linus Torvalds in 1991. Linux is a UNIX-like operating system that is available in the form of open source with commitments from a number of application developers and the two large technology giants - RED HAT (http://www.redhat.com/) and NOVELL (http://www.novell.com/linux/). IBM has partnered with both Red Hat and Novell to develop the widest range of solution in the world. They have more than 600 developers dedicated to developing solutions on Linux platform (http://www-03.ibm.com/linux/). This paper presents a detailed understanding of Linux Enterprise System, its capabilities in a Networked environment and its application in the global IT market. The paper will cover the architecture, process of deployment, Innovations by Red Hat, popular applications, embedded applications and global acceptance of Linux Enterprise. Linux is one of the most popular systems in the world of open-source software systems. The global commitment to this open source operating system is extremely high. The concept of Open Source is that the basic kernel and other infrastructure components are available free that can then be used by organizations to apply customizations and build solutions to be sold in the market at a price. Hence Linux from Red Hat and Novel SUSE comes at a cost. The Linux is available freely at www.linux.org. Many high end software applications and RDBMS systems are developed on Linux that are running business critical IT systems for Customers. A list of applications supported on Linux is available at http://www.linux.org/apps/. A number of other open source platforms are developed on Linux platform which are today very popular in the commercial world. The most prominent among them are PHP (for application end coding), MySQL (RDBMS) and Apache (Web Server) (http://www.php.net/, http://www.mysql.com/, http://www.apache.org/). These open source platforms are again widely used in the global market just like Linux. These platforms are used by a number of companies to package and sell software applications for businesses. In addition, a number of hardware companies have developed hardware based solutions with embedded Linux. Some of the examples of widely used devices with embedded Linux are Barracuda Ani-Spam solutions and Sonicwall Firewall. The site http://www.linuxdevices.com presents a wide range of devices that use embedded linux as the core operating system. Linux Enterprise System Architecture Linux is a 32 bit & 64 bit operating system that is available on a wide range of hardware platforms - Intel, SUN Sparc, Power-PC, and Digital Alpha. The Linux on Digital Alpha is available in 32 bit as well as 64 bit variants. Linux has a kernel system that is similar to that of Unix. It has multi-tasking, multi-user and multi-processing support just like any other Server based Operating

Monday, November 18, 2019

Compare and contrast the romantic relationship Essay

Compare and contrast the romantic relationship - Essay Example In the movie The Princess Diaries 2: Royal Engagement, the love is illogical because it shows a false dichotomy by forcing Princess Mia to choose either Andrew Jacoby or Nicholas Devereaux to be her future husband; in contrast, â€Å"Love is a Fallacy† does not reveal true love because the character chose love based on logic. These two love stories reveal that love can be logical, illogical, or emotional, and therefore may not always be true love. The movie The Princess Diaries 2: Royal Engagement is about Genovia’s Princess Mia Thermopolis, who has to find a husband so that she can take her grandmother’s place as the Queen of Genovia. Mia starts to find a man that meets her ideal criteria as a husband. From all of the men that have been introduced to her, she discovers Andrew Jacoby, the Duke of Kenilworth. She starts to date Andrew but then discovers Nicholas Devereaux. Mia and Nicholas always fight but while they are fighting, their love starts to grow. There is a dilemma inside Princess Mia’s heart: to choose Andrew or Nicholas. This situation seems illogical because when people are in love there are no concrete reasons for why they are in love. Princess Mia would choose Andrew because he is the Duke of Kenilworth and she would become the queen of Genovia. When true love appears in someone’s life, they tend to act illogically and are unable to think straight. On the other hand, the purpose that Nicholas wants to be with Princess Mia is because his uncle wants him to become the King of Genovia for the benefit of their family. At first, Nicholas uses this logical thinking to get Princess Mia, but as the story progresses, he falls in love with her without using logic. He believes that he will lose Princess Mia because she will marry Andrew, but Princess Mia finally decides not to marry Andrew because he is not her true love. To express his feeling to Princess Mia, Andrew said, â€Å"You are, in fact. I am in love with the Queen-to-be, and

Friday, November 15, 2019

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.

Wednesday, November 13, 2019

In what ways is Educating Rita effective as a play? :: English Literature

In what ways is Educating Rita effective as a play? 'Educating Rita" is dramatically effective in many ways. It is also recognised as an exceptional play; it was voted "Best comedy of the year" when performed by the Royal Shakespeare Company in 1980, and just three years after release, it had become the fourth most popular play in Britain. There are obviously factors which make it so effective, and I intend to explore these factors. Throughout the play, there are only two characters: this is known as a two-hander. Other characters are only mentioned in the play, but in the film have been cast as parts. It worked well for the film, but I think it lost the closeness which plays such an important part in the theatre. Some people would find this to be tedious, but I think it adds to the intensity and intimacy between the audience and the characters. There is a focus on the two characters which means that the audience can appreciate the relationship between Rita and Frank which is emphasised more than it would be with other characters, and would notice any subtle changes that occur in the play. For example, when Rita starts to use the correct form of speech for talking about literature and uses a higher standard of English. You can see this in Act I, Scene 4 when Frank and Rita were talking about her "Peer Gynt" essay where her response was "Do it on the radio." Frank could not believe what she had written as her entire essay, and in her defense Rita says, "I didn't have much time this week, so I sort of, y'know, encapsulated all me ideas in one line." The audience familiarise with Frank and Rita and we can see more closely what they are feeling and thinking because we know them better. We understand that Rita feels that she is stuck in the lower class and she wants to better herself by "changing from the inside" and taking Literature classes. Frank is a tired, middle-aged man and he can see that the world is passing by but he cannot be bothered to do anything about it. He drinks to try and suppress this feeling: "Life is such a rich and frantic whirl that I need the drink to help me step delicately through it." Both characters are stuck in a rut, but Rita wants to change her situation and is making the effort to achieve that change. We can also sympathise with Rita and Frank because of the closeness between audience and characters, and so this can make otherwise trivial circumstances seem more significant, such as when Rita

Sunday, November 10, 2019

The Business Process Outsourcing Industry

The current study aims to contribute to the dearth of literature on the motivational factors that influence the motivation of Indian business process outsourcing professionals who are deployed to the UK. The study further acknowledges the need to address the peculiar motivational needs of different professions operating amongst distinct industries. Because the business process outsourcing industry is a sunshine industry that holds much promise of progress, key players within this realm must be able to address all the concerns of consultants which they deploy offshore to ensure greater probability of success of offshore projects.The results of a survey with 60 BPO professionals in the UK suggest that the highest ratings for motivational factors are clarity of instructions with tasks; presence of clearly-defined and performance-based indicators; and presence of clear, well-defined goals. Notably, all factors are under the rule enforcement cluster of Katz & Kahn’s model of motiva tion. The respondents also expressed that the lowest motivational factors are competitive pay; having loyalty as a basis for rewards; and having seniority as a criterion for reward.All these items belong to the cluster of external rewards. Logically, the highest rated motivation cluster is rule enforcement, while the lowest rated is external rewards. Based on the stepwise regression results, the positive, significant predictors of overall motivation include skills development, having realistic job expectations, lessened absenteeism as a result of motivation, seniority as a criterion for reward, and requiring less instruction or independence.All factors are positively correlated with overall motivation, except for having realistic job expectations, which has a negative correlation with the dependent variable. This means that as job expectations become more realistic, there is a tendency for overall motivation to decrease correspondingly. Motivational Factors of Indian Offshore Consul tants in the UK: An Empirical Study Introduction Numerous empirical researches have focused on the study of motivation and job satisfaction of employees in western contexts, but few have focused on Indian BPO employees.Parikh & Ghosh (2006) have emphasized that reward perceptions of collectivist culture employees are strongly determined by the nature of their cultural heritage and that they put greater premium on the good of the many rather than on their personal interests. The effects of culture are further discussed by Thomas & Philip (1994) in his study of management in India, investigated the applicability of Western motivational theories in the context of India. These researches, among others, point out to the diverse array of factors that influence reward perceptions, and ultimately affect employee productivity.The current study aims to contribute to the dearth of literature on the motivational factors that influence the motivation of Indian business process outsourcing profes sionals who are deployed to the UK. The study further acknowledges the need to address the peculiar motivational needs of different professions operating amongst distinct industries. Because the business process outsourcing industry is a sunshine industry that holds much promise of progress, key players within this realm must be able to address all the concerns of consultants which they deploy offshore to ensure greater probability of success of offshore projects.Justification of the Study Culture and cognition exert a strong impact on the psychological work expectations and ensuing attitudes of employees. There are various variables that influence the job satisfaction of employees and these have been empirically investigated across countries (Earley, 1993). Despite the voluminous literature on job satisfaction, there is a dearth of studies that focus on the reward systems accorded to employees from collectivist cultures such as India (Graf et al, 1990), much more in the more specif ic context of BPO industry, investigating the applicability of Western reward systems in their context.Past empirical studies have focused on a comparison between Western and Eastern employees’ reward perceptions (Dubinsky, 1994). These studies have found that such perceptions are significantly affected by their respective cultures, and the norms that come with it. Values, in turn, will affect the appeal that certain rewards have on the members of the sales force. It is critical for organisations to be aware of the most appropriate rewards strategies because this have a direct effect on the sales person’s performance and productivity (Dubinsky, 1994).There has been no study to date that has focused specifically on the perception of rewards of BPO offshore consultants deployed to the United Kingdom. This study will permit timely and appropriate considerations in drafting the most optimal reward system for this group. This is the rationale for carrying out the current st udy. Review of Related Literature Revisiting the Process Theories of Motivation Process theories present viable explanations for the factors that have an impact on a person’s motivation, particularly on why he selects one course of action over another.These are categorized into cognitive and non-cognitive groups. Cognitive theories assert that behaviour engages mental processes while non-cognitive theories propose that these are caused more by situational factors. The primary cognitive theories include equity, goal setting, and expectancy theories which all emphasize the perceptions of results that are an effect of a specific course of action (Adams, 1965). The first cognitive theory, equity theory suggests that motivation is a type of exchange in which persons use internal equilibrium in choosing a course of behaviour.It projects that employees will select the option which they evaluate as most fair. The parts of the theory include inputs, outcomes, comparisons, and results. By definition are the traits that a person brings to the situations and the tasks that are necessary. On the other hand, outcomes are what the person benefits from the situation. The third component, comparisons is what transpires when the person weighs their inputs to some benchmark standard.Results or outcomes consist of the attitudes and behaviours that stem from their comparison, with the latter being perceived as equitable for equilibrium within the individual to exist (Adams, 1965). The next type of cognitive theory, goal setting theory, presents that individuals target goals and those enterprises may exert impact on their course of action by influencing these targets. The primary parts of such theory include intentions, performance standards, goal acceptance, and the effort expended. The aggregate effect of these components determine motivation.The engagement of an individual in goal setting is expected to enhance his sense of engagement and dedication to the company. Group setting is perceived to be less effective than individual goal setting because it lessens accountability for goal accomplishment. The objective or the goal is the most critical component of this theory; and such are deemed more effective when set with reasonable difficulty. While engagement in the setting of objectives enhances the likelihood of satisfaction, it does not necessarily result in more optimal performance (Mitchell, 1979).The third cognitive theory is expectancy theory, which asserts that individuals select the course of action which they perceive will yield the most optimal benefit. It further says that employees will seek different courses of action and finally select the alternative which will cause them to reap a desired outcome or reward. The theory has lent itself substantially to empirical testing and it has good predictive validity in making predictions about choice of jobs, satisfaction with work, and to a lesser degree the effort that the person will exert at w ork.In addition, the theory indicates that the individual’s expectations of being rewarded is as critical as his perception of the relationship between his actions and the rewards which he anticipates from the enterprise. Another implication of the theory is the uniqueness of individuals in the way rewards appeal to them; as such, companies must be prudent in being able to offer rewards which are deemed appealing by their employees (Mitchell, 1980). In connection with this, Hartog et al (1999) asserts that the perceptions of the social environment is influenced by the culture of the beholder.In effect, the ideal traits of leaders vary across cultures. Hunt, Boal and Sorenson (1990) propose that societal culture has an important impact on the development of superordinate category prototypes and implicit leadership theories. They hold that values and ideologies act as a determinant of culture specific superordinate prototypes, dependent on their strength. There is premium attac hed to a more profound comprehension of the manner in which leadership is manifested across different cultures.Thus, there is also a need for empirical research in this area to be able to understand the distinctions of leadership behaviour and its efficacy across cultures (House, 1995). Hartog et al (1999) asserts that there are various cultural profiles that have been culled from Hofstede’s framework of cultures and which have garnered various testable hypotheses on cross-cultural leadership. These encompass the dimensions of uncertainty avoidance, power distance, masculinity-femininity, individualism-collectivism, and future orientation.There are cultures which are distinguished by strong uncertainty avoidance, and which put high importance on leaders’ compliance to protocol, rules, and customs. This is not too applicable for low uncertainty avoidance cultures (Hartog et al. , 1999). In low uncertainty avoidance cultures, innovation is encouraged. Moreover, paternali stic cultures espouse leaders who are authoritative, as compared to maternal cultures. The latter prefer leaders who are engaging and sensitive as opposed to directive (Hartog et al. , 1999). In the study conducted by Gerstner and Day (1994), they have investigated the differences in leadership prototypes.In particular, the respondents were asked to rate 59 leadership traits. There were 35 American students and between 10-22 offshore students from seven nations; the results suggest that the strength of leader trait associations were distinct across cultures and native country. Considering the constraints of limited sample size, having to enlist students as respondents, and selecting offshore students who were then studying in the United States as representatives of other cultures, and having an unvalidated trait rating tool, there have been reliable distinctions found in their perceptions of leadership traits (Hartog et al, 1999).

Friday, November 8, 2019

War in the 20th century

War in the 20th century As a reaction to rapid industrialization, many reforms were needed in the late 19th and early 20th centuries. With railroads raising prices for short distance rides and the high cost to ship goods farmers found their funds to be insufficient and crops began to fail. The new problems that farmers faced caused them to have to move and find new techniques in crop production. Eventually laws were passed to help regulate the prices of railroads.During the Agrarian Movement many farmers faced problems. One of their problems was overproduction, the opening of the west, machinery, and new techniques increased production and caused prices to fall. High costs of railroads made it very difficult for farmers to ship goods. The railroads charged higher prices and higher rates for shorter distances. Another problem was the farmers had to borrow money to make improvements, buy machinery, and banks charged high interest rates. The last problem the farmers faced was crop failures/disasters.The Journa l of the Gilded Age and Progressive EraThe farmers had to deal with droughts, insects killing the crops, floods, and bad crops wiping out saving crops from other years.In order to make crop harvests abundant; farmers came up with new methods and ideas so that their crops would be more sufficient. For starters, they moved from the coast to the Great Plains, but a lack of water and wood created serious problems. The prairie had fertile soil but was covered by a thick sod with thick roots. Deere's new steel plow was able to break up the thick sod. Because the sod was so thick, settlers were able to make bricks out of it and build houses with walls several feet thick. Also barbed wire was used instead of wooden fences in order to keep animals away from the valuable crops. Windmills were used to pump water...

Wednesday, November 6, 2019

Micro- and Macro-Sociology Essays

Micro- and Macro-Sociology Essays Micro- and Macro-Sociology Essay Micro- and Macro-Sociology Essay Hungarian Kay Track and One World under business Drabber Lovely hula hands by Hungarian Kay and One World Under business by Drabber, I find both articles very interesting and inter-related because it displays a connection in the micro- and macro sociology. Lovely hula hands can be analyzed from the micro sociology because it is concerned with daily human interaction such as social status, social role and social interrelations that take place in the central place of the article. The author does not generalize and abstract social trend but describes the real situation. One world under business concentrates more of the evolution of social structure related to macro sociology; his article contains not only sociological critiques but the product of the sociological imagination and levels of theoretical abstractions and also his contribution to the modern sociology today. I found both articles interesting because they have a unique relationship almost similar to an extent of again who has the power? Who has the Authority? Brings about impacts socially, economically, politically as well as culturally, and both articles face the same argument of authority and power. Lovely Hula Hands describes the modern life of the Hawaii from the Native Hawaiian point of view. Haunt Kay Track explores the cultural modification and exploitation of Hawaiian Culture including their language, dress and dance forms have been marketed as products for mass consumption of tourists (88). We know clearly that exploitation occurs when aspects of subculture, such as belief, ritual and social customs, are marketed without the cultural groups permission. And in todays world many racial ethnic groups like e. G Native America, Latino etc have experienced cultural exploitation and this is true today. We see people trapped in two worlds (culture) of which one is ours and the other one is forced upon us without any consent. And for this fact Native Hawaiian are trapped in this sort of two worlds one due to tourism which gave rise to high living costs in Hawaii and ruined the traditional indigenous life-style. Hawaiian cannot live as they lived in pre-tourism period, but also they cannot meet new life standards. Haunt Kay talks about how Hawaiian fill up the unemployment lines, and if they want to survive they either enter the military, work in the tourist industry, or leave Hawaii not by choice but out of economic necessity. It is absolutely horrendous that the people of Hawaii working in the tourist industry make a yearly salary of $10,000 to $25,000 which is barely enough for them to live in their own homeland it is sad but true. Looking at the figure that is the low income wage here in the United States, low income individuals still get some kind of help from the government in the united states which helps a little but for the case of the Hawaiian it is different. Why do we think we have so many crime, suicides rates, poverty etc because we are business indeed that we use resources even if it does not belong to us to profit from it. It can be either exploiting ones culture or fighting with other countries so that we can get their resources egg oil. It amazes me what is happening to sacred culture today, we all see ourselves living in this westernizes civilization I ask this question: Do people even care about history? About tradition? About the land we live on? Clearly not for us economy, and cultural impact. Instead of solving one problem we create another. Again rich, power and authority plays a role. To some of us culture is what defines us s individuals our beliefs, traditions are what keeps us at ease, prospers us, we learn to depend on ourselves and Mother Nature. Lets assume that Hawaii was not taken over by industrialization would they manage to survive? Yes they would, for many years they lived that way depending on their resources they have, united as one community and helping each other. Tracks compares the culture exploitation with prostitution, she emphasizes the femininity of Hawaiian culture are like agencies to the pimps, which makes a prostitute to sell her beauty. The native culture was banned from 1990 and its revival in sass as closely connected to tourist exotic language, costumes and dances turned to the lure for tourists. Track declares that communication of hula dancers were made smutty and salacious rather than powerfully erotic as they once were and today the word aloha that meaner the familial love to people and land now becomes almost meaningless because it is often used and has lost its uniqueness and value. Most culture see the exploitation and those are the once are easily taken advantage off, most off which the high chair have the say and the low chair have to suffer for it. Drubbers One World under Business describes how democratic ideals are used to spread capitalism across the world, which he calls corporate. He says how in a robust democracy, there is a firewall between government and business. The firewall ensures that people rather than business control the government and make the rules (Drabber, 429). However, in our democracy, governments interest lies in protecting profits, while corporations use the language of social responsibility to mask their undemocratic actions. While corporat e elites are part of that exclusive club that we envy. Corporations do it in reverse by using democratic language instead of profit-maximizing language to mask undemocratic behavior. Also, countries with very low GAP have no choice but to trade their political power for economic growth and as Friedman said, your political choices Get reduced to Pepsi and Coke (Drabber, 433). We have less political power and corporations have more political power and in order for us to accept that, we hold onto having economic power or democracy (which we do not really have) and corporations claim to show social accountability. This allows corporation to define their own rules, such as aging free trade interchangeable with deregulation, which does not help poorer countries grow, but makes them weaker. Also, these large corporations become huge moneymaking monopolies, Just as the mainstream products we have within our country. Surprisingly in todays democratic society, we rest on the ideal of individualism and freedom. We are supposed to have the freedom to vote, freedom to buy (as consumers), and freedom to choose, all of which are own personal, individual choices with no influence by or reliance on others, that is where the major contradiction in our society lies. Although we think we are individualistic and have freedom, but we do not realize that we are extremely dependent on others for our livelihoods and that only have freedom from traditional and formal institutional structures, but not other freedoms, such as psychological freedom, social and under lets us be indifferent to the suffering that our type of society causes others and ourselves and as a result we feel less accountable to it. Drabber discuss the contradictions of individualism and the bi-polar nature of freedom through publicity and corporate, respectively, and how it affects us socially, politically and economically. Furthermore, Just as consumers, corporations through free market and individualistic ideas do not feel accountable to the people that they depend on their workers and the peripheral countries they rely on for raw materials (also, additional workers and consumers). Drabber described this as uncoupling, which is when the corporation removes itself from the interest of the nation or citizens of a nation. They claim equal loyalty to all nations, once again cushioning it in democratic language. Also, it forces developing nations to be entrapped further in the corporation world and transfer their political power into power as a consumer, exulting in governments who are not able to be accountable to their own people because they are restricted by corporations and global financial market institutions (MIFF, WTFO, etc. . Through the abuses of the poorer people in these developing countries, the powers we have in our own countries are undermined. Although corporations would like for us to believe that we have an economic democracy or economic choices, we do not because we cannot regulate our own economic system that basically tells us what we want. As Drabber says, Real democracy is one person, one vote. One dollar, one vote, is the logic of the market, but it is opposite of the equal representation of all citizens that democracy is about. As a sovereign principle, one dollar, one vote, is inherently undemocratic, and it ensures a growing gap between rich and poor because it gives the rich far more political representation ( 439). These rich corporations have a lot more money than most of us and in result have a lot more political and social say in our market democracy. (Rich, Power and authority) also, in this market democracy, those who do not have any money have no a say at all. Countries look at our society as The Free World because the lack the economies and capital to buy all the stuff we have (the ability to choose products). In our society, with the poor and now even the middle- class, it is becoming more difficult to buy the necessities we need, even though we can see the things we would like to have through advertising. More and more, people have to choose between food, shelter, medication, health insurance and other needs. Still, corporations do not care as long as the consumers buy their products and consumers still try to buy it, even if they do not have the money for it (get loans, credit cards, etc. ). In the end, corporations get their money and often more money Han the products were actually worth. As we see that these articles supplement each other because they describe the same phenomena; Globalization, Lovely Hula hands shows impact of globalization on a person or group of people(Hawaiian) meanwhile one world under business describes the influence of globalization into the whole society. Both articles have an outstanding or rather interesting facts which I would agree that these facts take place everyday in our day to day society. Having said this they share an outstanding sociological significance because they concern to the different branches of sociology.

Monday, November 4, 2019

Palestine israeli conflict for international relations class Research Paper

Palestine israeli conflict for international relations class - Research Paper Example The common thing in both perspectives of the Israeli and Palestinian conflict is that the main reason is on the issue of land and there are serious consequences that accompany the conflict. There has been loss of land, loss of lives and immigration of the people from their ancestral lands in order to obtain safety in other countries. The research on international relations relate to the Palestinian Israeli conflict. The research paper examines the conflict from a Palestinian perspective. The research will conduct an analysis of the cause of the conflict, which constitute the factors that led to the start of the fight. The history of the conflict helps in understanding the causes, effects, interventions, and future of the conflict. The two parties could just have easily settled their conflicts amicably, but this has not been the case. Both territories have seen the need for continuing to fight a war that started way before they existed. The help from outside parties in trying to arbitrate the conflict have further pushed the countries into further and more serious measures of dealing with the conflict. There are several impacts that have resulted from the conflict. Israel, for example, has become a highly militarized country, with every gender from the teenage years becoming full soldiers. It is a rite of passage for the children to become soldiers when they reach a certain age. For the Palestinians, the oppression they have suffered at the hands of the Israelis has made them have a lot of hate and distrust for the Israelites. The Palestinians also do not have trust in the external parties who have had a history of favoring the Israelites over them when it came to the conflict. The Palestinians further blame outside forces for heavily contributing to the fight. From the Palestinian perspective, the Palestinians are the wronged party, and they would not concede to the Israelites. They want revenge and

Friday, November 1, 2019

Administration Essay Example | Topics and Well Written Essays - 500 words

Administration - Essay Example Likewise, knowledge, change and globalization are the three driving force of this era. Consequently, various transitions were brought out; and so most businesses go all-out to adapt to this phenomenon.First, most businesses today were highly globalized, they were conducted by the used of modern gadgets. People from around the world are working together to achieve a common goal. Even they were being raised with different cultures and beliefs, their mutual interests bind them to do business together. To think about all this happenings, the role of the administration is quiet hard, isn't it Back in the 90's, businesses conducted communication through the use of fax machines or telephones. This time, two individuals from two countries can do a conversation without any communication barriers-face to face. However, consequent to this are the technical, cultural and linguistic challenges of globalizations hence managers have to adjust in the midst of these diversities. Technically, as globa lization takes its place, old business entities need to update all their gadgets to compete in the global market or take advantage of the rapid technological change.